lostandfound over evolutie

Discussies over de evolutieleer, creation science, 'jonge aarde' creationisme, de zondvloed etc..

Moderator: Moderators

Gebruikersavatar
Erik
Bevlogen
Berichten: 4109
Lid geworden op: 02 mar 2005 18:06
Contacteer:

lostandfound over evolutie

Bericht door Erik » 27 jun 2008 16:22

Afgesplitst van Tegenstrijdig? (Socratoteles).


Ik denk dat er iets mis is gegaan lostandfound bij je reactie op mijn bericht van Ma Jun 23, 2008 3:03 pm
Die kwam namelijk in mijn PB inbox terecht.
Dus maar even hier neer gezet.
lostandfound schreef:Christenen die de evolutie accepteren, is een groot woord.
Hoezo??
Kenneth Miller bijvoorbeeld is geen christen?
Graag wat toelichting!
lostandfound schreef: Als je goed kijkt naar alles is er een zekere evolutie... micro-evolutie. Daar gelooft eigenlijk iedereen in, dacht ik zo. Daar is ook bewijs voor. Als evolutionist weet je denk ik wat dit betekend ed.
Macro-evolutie echter is afgeschreven als complete onzin. Omdat het Theoretisch al niet mogelijk is, laat staan in de praktijk.
Vele kleine stapjes maken 1 grote stap.
Microevolutie = macroevolutie
http://www.talkorigins.org/indexcc/CB/CB901.html
lostandfound schreef: ik heb hier een kort stukje, samengevat uit een boek van Micheal Cremo (ook terug te vinden in het boek van "... Hobrink-Evolutie, een ei zonder kip")
Devious is je vast dankbaar dat je weer eens een ouwe koe opvist. :lol:
http://www.freethinker.nl/index.php?opt ... &Itemid=37
lostandfound schreef: Ook is er bewijs dat de evolutie-theorie grotendeels is gebasseerd op valse informatie, door verschillende paarden-rassen van hele andere continenten bij elkaar te brengen. (terug te vinden in "Moderne wetenschap in de bijbel")
Toon me deze bewijzen.
lostandfound schreef: Ook is er bewijs dat dieren zich alleen aanpassen als het perse moet (noodzakelijkheid, survival of the fittest), waarom zou een vis dan opeens pootjes krijgen, een een hagedis vleugels.
En zonet zei je nog dat macroevolutie niet bestaat?!
lostandfound schreef: Ik zou hier graag met je verder over discusiëren, echt waar!, ik hoop dan ook op reactie. Ik vind dit namelijk altijd leuke discussies.
ik moet nu echt weer weg, ik ben gewoon zeer druk nu even, en dit is mijn vrije dag, en die wil ik graag leuk besteden met mijn naasten.
Wil JIJ discussiëren of wil je gewoon teksten oplepelen uit anti-evolutieboekjes uit christelijke hoek?

Gezien je reactie heb je niet eens de moeite genomen de links te bekijken die ik je gaf.
Je hebt geen idee hoe evolutie werkt en je hebt je nog nooit één moment in de theorie verdiept.
Je praat godsdienstwaanzinigen als Hovind na als een kip zonder kop.
Dat is geen discussie waard.

Als je meent dat je echt stevige argumenten hebt dan denk ik dat je maar eens een topic aan moet maken in het subforum evolutie.
Ik daag je uit.
lostandfound schreef: God's Zegen
Welke god?
Dit soort afsluiters laat je liever weg ik wordt er altijd onpasselijk van.

Probeer eens:

Met vriendelijk groet of gewoon niets.
De achtste hemel is het atheïstische inzicht dat de werkelijkheid weliswaar hard is maar wel de werkelijkheid en die is zoveel waardevoller dan alle mooie, verzachtende sprookjes bij elkaar. (Gerard)

Geleid wordt enkel hij die zichzelf niet gevonden heeft. (Rereformed)

Gebruikersavatar
collegavanerik
Superposter
Berichten: 6121
Lid geworden op: 31 mar 2005 22:59
Locatie: Zuid Holland

Bericht door collegavanerik » 27 jun 2008 22:48

lostandfound schreef: Ook is er bewijs dat dieren zich alleen aanpassen als het perse moet (noodzakelijkheid, survival of the fittest), waarom zou een vis dan opeens pootjes krijgen, een een hagedis vleugels.

Tja, waarom? :D
Afbeelding
Afbeelding
Afbeelding Hebr 6:
5 wie het weldadig woord van God en de kracht van de komende wereld ervaren heeft 6 en vervolgens afvallig is geworden, kan onmogelijk een tweede maal worden bekeerd.
Als er een almachtige god bestaat, dan is hij een sadist.

lostandfound
Berichten: 11
Lid geworden op: 20 jun 2008 19:09

Bericht door lostandfound » 28 jun 2008 05:25

Het onderwerp had opzich weinig te maken met de rest, en aangezien jullie zeer gesteld waren op het ontopic gedeelte pb'e ik je.
Erik schreef:
lostandfound schreef:Christenen die de evolutie accepteren, is een groot woord.
Hoezo??
Kenneth Miller bijvoorbeeld is geen christen?
Graag wat toelichting!
als je goed kijkt, dan zie je dat ik er gelijk onder iets over micro en macro evolutie heb geschreven. dat heet toelichting ;)
Erik schreef:
lostandfound schreef: Als je goed kijkt naar alles is er een zekere evolutie... micro-evolutie. Daar gelooft eigenlijk iedereen in, dacht ik zo. Daar is ook bewijs voor. Als evolutionist weet je denk ik wat dit betekend ed.
Macro-evolutie echter is afgeschreven als complete onzin. Omdat het Theoretisch al niet mogelijk is, laat staan in de praktijk.
Vele kleine stapjes maken 1 grote stap.
Microevolutie = macroevolutie
http://www.talkorigins.org/indexcc/CB/CB901.html
nee, micro evolutie is zoals een hond. Je ziet het verschil tussen een labrador en een Golden Retriever.
Erik schreef:
lostandfound schreef: Ook is er bewijs dat de evolutie-theorie grotendeels is gebasseerd op valse informatie, door verschillende paarden-rassen van hele andere continenten bij elkaar te brengen. (terug te vinden in "Moderne wetenschap in de bijbel")
Toon me deze bewijzen.
Moderne wetenschap in de bijbel ;)
Erik schreef:
lostandfound schreef: Ook is er bewijs dat dieren zich alleen aanpassen als het perse moet (noodzakelijkheid, survival of the fittest), waarom zou een vis dan opeens pootjes krijgen, een een hagedis vleugels.
En zonet zei je nog dat macroevolutie niet bestaat?!
zeg ik ook, dit is micro-evolutie, ik hoopte dat je dat toch wel doorhad, aangezien micro evolutie in zijn eigen aardsoort blijft.
Erik schreef: Wil JIJ discussiëren of wil je gewoon teksten oplepelen uit anti-evolutieboekjes uit christelijke hoek?
hangt er vanaf of jij ook christelijke boeken aanneemt voor waarheid, aangezien dat ook gewoon wetenschappers zijn. Ik lepen niet gewoon teksten op, dat doe jij door gewoon programma's en links te sturen...
Erik schreef: Gezien je reactie heb je niet eens de moeite genomen de links te bekijken die ik je gaf.
Je hebt geen idee hoe evolutie werkt en je hebt je nog nooit één moment in de theorie verdiept.
Je praat godsdienstwaanzinigen als Hovind na als een kip zonder kop.
Dat is geen discussie waard.
haha, ik heb hovind nooit gezien, en heb darwins theorie (lang geleden) gelezen, die was heel beknopt, later op tv meer van gezien, en afgewezen na meerdere boeken te hebben gelezen.
God zal alle tranen van hun ogen afwissen; en de dood zal niet meer zijn; noch rouw, noch gekrijt, noch moeite zal meer zijn; want de eerste dingen zijn weggegaan.
Openbaringen 21:4

The world doesn't need less darkness, but more light

Gebruikersavatar
CXT
Bevlogen
Berichten: 1889
Lid geworden op: 06 nov 2007 18:03

Bericht door CXT » 28 jun 2008 10:20

@lostandfound: Waar zit volgens jou de grens tussen micro- en macro-evolutie? Soorten passen zich aan, dat erken je. Als je over een zeer lange periode kijkt, gaan die aanpassingen heel ver en is er sprake van een nieuwe soort. Als je beweert dat dit niet kan, zal je de grens aan moeten geven waar deze evolutie stopt, zodat het enkel binnen soorten blijft.

W.b. het boek 'Moderne wetenschap in de Bijbel' van Ben Hobrink, daar kan Sararje leuk over meepraten. :D Trouwens, als je om bewijzen wordt gevraagd, zouden we deze graag zien in de vorm van een voorbeeld of een feit met bronvermelding. Aan de naam van een boek hebben we niet zoveel, tenzij onze interesse dermate opgewekt is om het werkelijk te kopen. ;)

Wat christelijke boeken betreft, het is niet zo dat we alles wat christenen schrijven afstempelen als onzin. We zijn wel extra kritisch omdat christenen bepaalde aannames doen die nergens op gebaseerd zijn en van daaruit verder gaan redeneren. Daarnaast zijn er trouwens volgens mij maar weinig christelijke wetenschappers die het creationisme aanhangen.
Edwards: Why the big secret? People are smart. They can handle it.
Kay: A person is smart. People are dumb, panicky dangerous animals and you know it.
Men in Black

Gebruikersavatar
Sararje
Superposter
Berichten: 5994
Lid geworden op: 11 jul 2005 15:35

Bericht door Sararje » 28 jun 2008 11:40

Ja, moet hoognodig mijn kritieken op Ben Hobrink gaan plaatsen op dit forum. Ben Hobrink is naar mijn bescheiden mening een plagierende fraudeur die pertinente bullshi verkondigt aangaande bijbelrethoriek. Misschien toch maar volgende week het eerste deel van mijn kritiek gaan uploaden. Dat Ben Hobrink plagiaat pleegt, kan elke nitwit trouwens zelf zonder problemen vinden op het internet. Hele passages uit Moderne Wetenschap in de bijbel zijn rechtstreeks zonder bronvermelding overgenomen uit McMillen. Kortom: pure plagiaat en achterklap.
"De bijbel is net een spoorboekje van de NS, je kan er alle kanten mee op." - Fons Jansen
"Als er bij het dorp waar bergen bergen bergen bergen bergen, Bergen, bergen bergen bergen bergen bergen, bergen bergen bergen bergen bergen.". - Kees Torn

Gebruikersavatar
Erik
Bevlogen
Berichten: 4109
Lid geworden op: 02 mar 2005 18:06
Contacteer:

Bericht door Erik » 28 jun 2008 12:55

Moderatorverzoek: Graag een afsplitsing naar het subforum evolutie.
lostandfound schreef:als je goed kijkt, dan zie je dat ik er gelijk onder iets over micro en macro evolutie heb geschreven. dat heet toelichting
Nee, ik vroeg om toelichting omtrent het christen-zijn van Kenneth Miller.
Ik heb namelijk sterk de indruk dat jij christenen die de evolutietheorie aannemen niet als christenen beschouwd, ik wil graag weten wat jou definitie van een christen is.

De vraag omtrent micro en macro-evolutie acht ik voldoende beantwoord door de links die ik gaf en de reacties van CXT en collegavanerik.
Het is geouwe..... in de ruimte en al lang geleden weerlegde creationistische onzin.
lostandfound schreef:Moderne wetenschap in de bijbel
Er staat geen wetenschap in de bijbel.
Ik geef jou netjes kant en klare links met verwijzingen naar een DIRECT antwoord op jou vragen, jij laat mij een boek kopen waarin ik zelf het antwoord op moet zoeken.
Dat wil ik best doen maar ik wil vooral weten waar JIJ dat antwoord gelezen hebt en waarom je meent dat dat een afdoende antwoord is.
Dus bronvermelding (boek, pagina, alinea etc.), qouten uit een werk, links naar online gegevens, peer review etc. etc.
lostandfound schreef:hangt er vanaf of jij ook christelijke boeken aanneemt voor waarheid
Uiteraard, mits ondersteund door deugdelijk wetenschappelijk onderzoek.
Maar ik maak ik wel uit op dat christelijke boeken voor jou de enige geldige informatie is?
lostandfound schreef:aangezien dat ook gewoon wetenschappers zijn.
Ik heb nergens gezegd dat er geen christelijke wetenschappers bestaan, sterker nog ik heb je links gegeven naar 1 van hen.
Weet je nog Kenneth Miller die hier (vanaf timeindex 3:28 ) uitlegd hoe klein jij je god maakt door de evolutietheorie-bewijzen te ontkennen.
lostandfound schreef:haha, ik heb hovind nooit gezien
Ik vind dat niet om te lachen, ik vind het eerder zeer triest dat de argumenten die je geeft christelijke eenheidsworst blijkt te zijn.
Hovind, Hobrink, Behe etc. ze tappen allemaal uit hetzelfde dogmatische onwetenschappelijke vaatje!
lostandfound schreef:en heb darwins theorie (lang geleden) gelezen, die was heel beknopt, later op tv meer van gezien, en afgewezen na meerdere boeken te hebben gelezen.
Beknopt?? In welke zin?
En voor het geval je het nog niet in de gaten hebt, we zijn ondertussen 150 jaar verder.
Darwin heeft de basis gelegd en sindsdien is evolutie bewezen op alle wetenschappelijke fronten.
Dus ik ben nu erg benieuwd op welke gronden jij evolutie afwijst!
Welke boeken heb je bijvoorbeeld gelezen om mee te beginnen?
De achtste hemel is het atheïstische inzicht dat de werkelijkheid weliswaar hard is maar wel de werkelijkheid en die is zoveel waardevoller dan alle mooie, verzachtende sprookjes bij elkaar. (Gerard)

Geleid wordt enkel hij die zichzelf niet gevonden heeft. (Rereformed)

Gebruikersavatar
Sararje
Superposter
Berichten: 5994
Lid geworden op: 11 jul 2005 15:35

Bericht door Sararje » 28 jun 2008 19:29

Ik ga het even niet afsplitsen omdat er momenteel maar twee postings over gaan. Maar ik doe hierbij wel een zeer dringend verzoek aan lostandfound om bij het onderwerp te blijven. Als hij zijn skepsis over evolutie wil luchten aan de hand van welke leidraad dan ook, dan is dat prima maar dan mag hij zelf een nieuw draadje openen. In dit draadje blijven we ontopic.
"De bijbel is net een spoorboekje van de NS, je kan er alle kanten mee op." - Fons Jansen
"Als er bij het dorp waar bergen bergen bergen bergen bergen, Bergen, bergen bergen bergen bergen bergen, bergen bergen bergen bergen bergen.". - Kees Torn

lostandfound
Berichten: 11
Lid geworden op: 20 jun 2008 19:09

Bericht door lostandfound » 30 jun 2008 15:29

Sararje schreef:Ik ga het even niet afsplitsen omdat er momenteel maar twee postings over gaan. Maar ik doe hierbij wel een zeer dringend verzoek aan lostandfound om bij het onderwerp te blijven. Als hij zijn skepsis over evolutie wil luchten aan de hand van welke leidraad dan ook, dan is dat prima maar dan mag hij zelf een nieuw draadje openen. In dit draadje blijven we ontopic.
sorry maar vraag aub hier iemand over, ik stuur heel netjes een PB. Anderen zetten het hier.
Ik ben hier nu zo'n 2 weken, en heb 4 kritiek berichten gehad, waarvan 1 terecht over offtopic gaan, of dat ik hier al geweest zou moeten zijn oid. Ik verwacht dat dit niet meer gebeurt, omdat ik me toch aangevallen voel, aangezien het allemaal op mij wordt gericht erwijl ik niks doe.
Dus Sararje wil je een afsplitsing maken, omdat er sommige mensen zijn, die mijn pb's in het verkeerde topic zetten! Dit is een "heel dringend verzoek"



Erik ten eerste bepaal ik niet wat christenzijn is, gelukig niet. Zelf geloof ik niet dat macro-evolutie in het christendom past, omdat dat het creationisme tegenspreekt.

Verschil macro/micro evolutie:
Micro blijft binnen de aard/hoofdsoort (zie het als honden, golden retriever+bulldog=vuilnisbakkenras)
Macro bevat een vorm van mutatie waardoor de hele aardsoort veranderd.
(paard wordt vogel oid).

http://www.creationism.org/heinze/examined.htm
1 van de bewijzen, waar ik het over had, aangezien een boek (wel of niet gejat, veel dingen duidelijjk wel, dat geef ik toe, maarja dat is zijn probleem) niet genoeg voor je is. Ik heb de bron heel lang niet meer gelezen, dus ik weet niet precies meer wat hierin staat.

"Oops! Biology Scientists Just Changed the "Scientific Facts" Again.

Science books have been telling us for years that all human are 99.9 percent genetically identical, and it is commonly said that humans “share” 98-99 percent of their DNA with chimpanzees. Now we find the claims were all fabricated lies. Instead of having only 0.1 percent difference between human individuals, we now find that people can be genetically different by as much as 10 to 12 percent. This is a 100 to 120 times increase in the degree of difference. This announcement is a another crushing blow to the false theory of evolution, but your university professor will simply ignore it.

Humans can be 10 to 12 percent genetically different, not 99.9 percent identical - November 22, 2006.

Scientists Revise Map of Human Genome
By Jessica Berman, Washington

"Scientists have revised the map of the human genome, saying human beings are genetically more complex than previously thought. The discovery has surprised experts who say it is likely to transform medical research. VOA's Jessica Berman reports."

"In 2000, the Human Genome Project unveiled a road map of the six billion chemical bases, or alphabet molecules, that make up the body's genetic structure called DNA."

"The DNA encodes for 30,000 genes or proteins which are responsible for every physical characteristic in the body, including eye and hair color. At the time, scientists said all humans could be 99.9 percent genetically identical."

"But as they peered more deeply into the DNA of unrelated individuals, researchers made a startling discovery - large segments of their DNA, from thousands to millions of units, varied greatly, a phenomenon called copy number variations, or CNVs."

"The discovery means that the genes of any given individual are at least 10 to 12 percent different from those of another human."

Don't believe your biology science text book. Modern biology is not a science. Modern biology as taught in high schools and universities is nothing more than made up conjecture and nonsense. Biology is not scientifically true. Biologists keep revising "science" that was previously taught as being fact. Engineers don't do that. Engineering is a science. Some people call engineering a pure science, meaning it is not made up nonsense, like biology. Engineers do not suddenly announce that the deflection in a beam under a given load has been discovered to be 100 times greater than previously thought. LOL (laughing out loud). Engineers often use the formula F=ma (force equals mass times acceleration). No engineer will publish a paper claiming it has been discovered that the acceleration is 100 times that previously thought. All engineers calculate the same level of stress in the shell of a pressure vessel given a fixed internal pressure. Engineering does not change because it is based on scientific facts, verified by accurate scientific experiments. Biology will always be changing because it is based on evolutionary nonsense. Biology has evolved, not humans. Biology is not a science. It is a joke. This web page encourages students to avoid a career in biology, because it is base of false conjecture. Students are encouraged to avoid taking a biology class if high school and/or college if at all possible, because it is simply brainwashing.

Now, can we expect to see a revision in all of the new biology science text books stating that the human genetic code can vary by 10 percent between individuals? No! This is the trouble with biology. The teachers, professors and text books will continue to claim that all humans are genetically identical within 99.9 percent. The day after the results of the above study was published, news reporters began lying and distorting the study results saying the difference to be 10 times, not 10 percent, which is actually 100 times. The lies will go on and on."
Bron: http://www.biblelife.org/evolution.htm (ergens halverwege/onderaan de pagina)
http://nl.youtube.com/watch?v=mDj-WSDvX ... re=related (filmpje tegen evolutie, niet heel sterk vind ik, maar nog steeds discutabel)
http://www.realtruth.org/articles/080602-003-eedfs.html
ook nog een linkje.

Erik er staat geen wetenschap in de bijbel?
dat is denk ik bijna hetzelfde zeggen als er staan geen cijfers in een wiskunde boek.
lees jij de bijbel aub eens en zie wat voor wetenschap er is op medisch gebied (als je alleen al de besnijdenis bekijkt, op de achtste dag, het verbannen van melaatsen naar een speciaal kamp, om weer rein te worden, en anderen niet onrein te maken)
Er staat wel heel degelijk wetenschap in de bijbel!



nu wil ik wel graag het bewijs zien, voro het ontstaan van de aarde.
het ontstaan van de mens uit een celletje.
(graag geen valse bronnen gebruiken, zoals dat de mens zoveel op de aap lijkt ;) )

@ Kronos God is wel zeker veranderbaar, in bepaalde opzichten

laterz
God zal alle tranen van hun ogen afwissen; en de dood zal niet meer zijn; noch rouw, noch gekrijt, noch moeite zal meer zijn; want de eerste dingen zijn weggegaan.
Openbaringen 21:4

The world doesn't need less darkness, but more light

Gebruikersavatar
Bonjour
Moderator
Berichten: 4929
Lid geworden op: 27 jun 2008 23:26

Bericht door Bonjour » 30 jun 2008 16:00

Leuk voorbeeld: F=m.a
F=m.a is fout. Dat heeft Einstein aangetoond. Dat heet relativitietstheorie en is net als de evolutietheorie gebaseerd op feiten. Dat heet wetenschap. Je doet observaties en zoekt een theorie die de observaties verklaren. En als het niet klopt pas je het aan. Kijk eens in de sterrenkunde hoe vaak dat gebeurd. Niks bijzonders.
En de biologie boeken worden wel aangepast. Het zijn geen bijbels.

Er zijn nu dus theorien hoe de aarde en de mens zijn ontstaan. Gebaseerd op observaties. Als jij een betere theorie gebaseerd op observaties hebt, ben je welkom om die ter discussie voor te leggen.
Misschien komen we ooit nog buitenaardsen tegen die het ontstaan van de arde hebben gefilmd, waarschijnlijk niet. Dus dat bewijs krijg je niet.
Wat je waarschijnlijk wel kan bewijzen is dat er teveel variatie in het menselijk DNA zit om van 1 man en 1 vrouw afkomstig te zijn. Hetgeen zou betekenen dat er mutaties zijn opgetreden sinds Adam en Eva, wat weer de evolutietheorie zou ondersteunen.

Als er een god is die alles geschapen heeft, heeft hij wel heel veel moeite gedaan om de mens te laten denken dat de evolutietheorie waar is.
(Sorry had bovenstaande post nog niet gezien toen ik begon te typen. Kan deze inzending verplaatst worden?)

gedaan (collegavanerik)

Gebruikersavatar
Socratoteles
Diehard
Berichten: 1120
Lid geworden op: 27 feb 2007 20:31

Bericht door Socratoteles » 30 jun 2008 16:11

lostandfound schreef:Dus Sararje wil je een afsplitsing maken, omdat er sommige mensen zijn, die mijn pb's in het verkeerde topic zetten! Dit is een "heel dringend verzoek"
Aan dat verzoek is nu voldaan. Nu van mijn kant het verzoek om niet weer zulke copy-paste reacties te leveren als die hierboven. Wij zijn tenslotte met jou in discussie, niet met een willekeurige crea-site. En we verwachten dus van jou dat jij zelf ook wat inbrengt, wat moeite steekt in je reacties, net als ieder ander.

Gebruikersavatar
Sararje
Superposter
Berichten: 5994
Lid geworden op: 11 jul 2005 15:35

Bericht door Sararje » 30 jun 2008 16:30

lostandfound schreef:
Sararje schreef:Ik ga het even niet afsplitsen omdat er momenteel maar twee postings over gaan. Maar ik doe hierbij wel een zeer dringend verzoek aan lostandfound om bij het onderwerp te blijven. Als hij zijn skepsis over evolutie wil luchten aan de hand van welke leidraad dan ook, dan is dat prima maar dan mag hij zelf een nieuw draadje openen. In dit draadje blijven we ontopic.
sorry maar vraag aub hier iemand over, ik stuur heel netjes een PB. Anderen zetten het hier.
Ik ben hier nu zo'n 2 weken, en heb 4 kritiek berichten gehad, waarvan 1 terecht over offtopic gaan, of dat ik hier al geweest zou moeten zijn oid. Ik verwacht dat dit niet meer gebeurt, omdat ik me toch aangevallen voel, aangezien het allemaal op mij wordt gericht erwijl ik niks doe.
Dus Sararje wil je een afsplitsing maken, omdat er sommige mensen zijn, die mijn pb's in het verkeerde topic zetten! Dit is een "heel dringend verzoek"
Ik kan niet zien wie een PB hier publiceert en wie niet, maar op verzoek is je topic afgesplitst door Socratoteles. Overigens doe je wel degelijk wat: je claimt dat evolutie niet het beste model vormt voor de beschrijving hoe soorten ontstaan maar creationisme is het beste model. Dat mag je hier best beweren (immers, we zijn niet van de gedachtepolitie). Wel heeft een ander net zo veel recht jouw stellingname en/of stelligheid in twijfel te trekken en ik verwacht gezien jouw stellingname dat dit zal gaan gebeuren. Ik zal vast de aftrap geven door op je posting te reageren.
Erik ten eerste bepaal ik niet wat christenzijn is, gelukig niet. Zelf geloof ik niet dat macro-evolutie in het christendom past, omdat dat het creationisme tegenspreekt.
Waarom zou ik het creationistische model voor beter houden? Omdat dat in de bijbel zo staat? Jammer maar helaas, maar a) Creationisme als beste model is een relatief nieuw idee. Bovendien: waarom zou ik van alle religieuze teksten juist het bijbelse scheppingsverhaal als leidraad nemen? kom nu ajb niet met het argument dat die van god komt, dat kennen we al en dat zal een moslim ook van zijn tekst beweren.
Verschil macro/micro evolutie:
Micro blijft binnen de aard/hoofdsoort (zie het als honden, golden retriever+bulldog=vuilnisbakkenras)
Macro bevat een vorm van mutatie waardoor de hele aardsoort veranderd.
(paard wordt vogel oid).
Leuk, maar geen enkele bioloog zal zeggen dat een paard een vogel wordt. Een bioloog zal volgens de evolutietheorie zeggen dat een paard en een vogel een gemeenschappelijke voorouder hebben. Overigens simpel vraagje: waar ligt het onderscheid tussen aard/hoofdras en soort?
http://www.creationism.org/heinze/examined.htm
1 van de bewijzen, waar ik het over had, aangezien een boek (wel of niet gejat, veel dingen duidelijjk wel, dat geef ik toe, maarja dat is zijn probleem) niet genoeg voor je is. Ik heb de bron heel lang niet meer gelezen, dus ik weet niet precies meer wat hierin staat.
Als we met linkjes gaan smijten, dan kan ik dat ook.
http://wiki.cotch.net/index.php/List_of ... _arguments
"Oops! Biology Scientists Just Changed the "Scientific Facts" Again.
Science books have been telling us for years that all human are 99.9 percent genetically identical, and it is commonly said that humans “share” 98-99 percent of their DNA with chimpanzees. Now we find the claims were all fabricated lies. Instead of having only 0.1 percent difference between human individuals, we now find that people can be genetically different by as much as 10 to 12 percent. This is a 100 to 120 times increase in the degree of difference. This announcement is a another crushing blow to the false theory of evolution, but your university professor will simply ignore it.
Humans can be 10 to 12 percent genetically different, not 99.9 percent identical - November 22, 2006.

Scientists Revise Map of Human Genome
By Jessica Berman, Washington
"Scientists have revised the map of the human genome, saying human beings are genetically more complex than previously thought. The discovery has surprised experts who say it is likely to transform medical research. VOA's Jessica Berman reports."
"In 2000, the Human Genome Project unveiled a road map of the six billion chemical bases, or alphabet molecules, that make up the body's genetic structure called DNA."
"The DNA encodes for 30,000 genes or proteins which are responsible for every physical characteristic in the body, including eye and hair color. At the time, scientists said all humans could be 99.9 percent genetically identical."
"But as they peered more deeply into the DNA of unrelated individuals, researchers made a startling discovery - large segments of their DNA, from thousands to millions of units, varied greatly, a phenomenon called copy number variations, or CNVs."
"The discovery means that the genes of any given individual are at least 10 to 12 percent different from those of another human."
Don't believe your biology science text book. Modern biology is not a science. Modern biology as taught in high schools and universities is nothing more than made up conjecture and nonsense. Biology is not scientifically true. Biologists keep revising "science" that was previously taught as being fact. Engineers don't do that. Engineering is a science. Some people call engineering a pure science, meaning it is not made up nonsense, like biology. Engineers do not suddenly announce that the deflection in a beam under a given load has been discovered to be 100 times greater than previously thought. LOL (laughing out loud). Engineers often use the formula F=ma (force equals mass times acceleration). No engineer will publish a paper claiming it has been discovered that the acceleration is 100 times that previously thought. All engineers calculate the same level of stress in the shell of a pressure vessel given a fixed internal pressure. Engineering does not change because it is based on scientific facts, verified by accurate scientific experiments. Biology will always be changing because it is based on evolutionary nonsense. Biology has evolved, not humans. Biology is not a science. It is a joke. This web page encourages students to avoid a career in biology, because it is base of false conjecture. Students are encouraged to avoid taking a biology class if high school and/or college if at all possible, because it is simply brainwashing.
Ja hoor, de grote samenzwering dat biologie de grote samenzwering is. Come on, geloof je dat werkelijk? Als een goed wetenschapper de goede argumenten hoort, is deze zonder problemen te overtuigen en is er geheel geen brainwashing voor nodig. Bovendien kan ik de bewering zo ontkrachten. Een gen bestaat uit een langer stuk DNA. De hoeveelheid genen is maar 30.000 en daar kan je zo 10% verschil in hebben. Maar in de DNAsequentie hoeft er maar een basepaar verschillend te zijn om in hetzelfde gen een mutatie te krijgen. Stel bijvoorbeeld ik heb het volgende gen:
AGTCAGTCGTAAATGCATGGT Dit is een mutatie van AGTCAGTCGTAAATGCATGTT
dit gen. Dan is de genetische verandering in de DNA 4% maar is er maar 1 uit 1 (=100%)genen anders. kortom: de bewering is cijfergegoochel.
Now, can we expect to see a revision in all of the new biology science text books stating that the human genetic code can vary by 10 percent between individuals? No! This is the trouble with biology. The teachers, professors and text books will continue to claim that all humans are genetically identical within 99.9 percent. The day after the results of the above study was published, news reporters began lying and distorting the study results saying the difference to be 10 times, not 10 percent, which is actually 100 times. The lies will go on and on."
Bron: http://www.biblelife.org/evolution.htm (ergens halverwege/onderaan de pagina)
http://nl.youtube.com/watch?v=mDj-WSDvX ... re=related (filmpje tegen evolutie, niet heel sterk vind ik, maar nog steeds discutabel)
Zie rekenvoorbeeld boven.
Prachtig je linkjes, maar dat zegt niets. Zeker niet als er wordt gesproken over cosmische evolutie. De bigbang-theorie valt onder cosmologie en heeft niets te maken met biologie. Blijf dus bij je onderwerp.
Erik er staat geen wetenschap in de bijbel?
dat is denk ik bijna hetzelfde zeggen als er staan geen cijfers in een wiskunde boek.
lees jij de bijbel aub eens en zie wat voor wetenschap er is op medisch gebied (als je alleen al de besnijdenis bekijkt, op de achtste dag, het verbannen van melaatsen naar een speciaal kamp, om weer rein te worden, en anderen niet onrein te maken)
Er staat wel heel degelijk wetenschap in de bijbel!
a) er is geen medische noodzaak voor besnijdenis. Peniskanker zoals Ben Hobrink beweert, komt uiterst zelden voor en besnijdenis is er vrijwel geen probaat middel tegen. Bovendien is de "wetenschap" dat bloed het snelst stolt vanwege de hoeveelheid prothrombine in het bloed op de achtste dag ook onjuist. (linkje kan je van me krijgen op verzoek) Bovendien is het verhaal van het verbannen van de melaatsen leuk, maar zegt helemaal niets.Tsa'arat zoals het Hebreeuwse woord luidt, is niet aantoonbaar als melaatsheid aangezien melaatsheid pas in de vierde eeuw vdgj is meegenomen uit India door Alexander de Grote.
nu wil ik wel graag het bewijs zien, voro het ontstaan van de aarde.
het ontstaan van de mens uit een celletje.
(graag geen valse bronnen gebruiken, zoals dat de mens zoveel op de aap lijkt )
Je springt twee maal van de hak op de tak in twee zinnen. De manier waarop de aarde is ontstaan, is geologie, de manier waarop leven ontstaat, is biogenese en de manier waarop de mensheid is ontstaan is evolutie. Je haalt zaken door elkaar die niets met elkaar te maken hebben.
"De bijbel is net een spoorboekje van de NS, je kan er alle kanten mee op." - Fons Jansen
"Als er bij het dorp waar bergen bergen bergen bergen bergen, Bergen, bergen bergen bergen bergen bergen, bergen bergen bergen bergen bergen.". - Kees Torn

Gebruikersavatar
Socratoteles
Diehard
Berichten: 1120
Lid geworden op: 27 feb 2007 20:31

Bericht door Socratoteles » 30 jun 2008 17:08

lostandfound schreef:Verschil macro/micro evolutie:
Micro blijft binnen de aard/hoofdsoort (zie het als honden, golden retriever+bulldog=vuilnisbakkenras)
Macro bevat een vorm van mutatie waardoor de hele aardsoort veranderd.
(paard wordt vogel oid).
Mag ik van jou... de wetenschappelijke definitie van 'aardsoort' of 'hoofdsoort'? Hond, vogel, vis, etc. werkt voor kleuters maar in de biologie moet je met heldere criteria komen.
"Oops! Biology Scientists Just Changed the "Scientific Facts" Again.
Als jij niet de moeite neemt om het in je eigen bewoordingen samen te vatten, dan neem ik niet de moeite om er op in te gaan. De schrijver valt overigens al door de mand nog voordat ik iets van dat artikel heb gelezen: hij citeert namelijk nergens uit het onderzoek, maar alleen uit een blog-berichtje van een leek die iets schrijft over dat onderzoek. In het onderzoek staat namelijk glashelder dat 10-12 % van de genen kunnen varieren, niet dat mensen genetisch 10-12% van elkaar verschillen. Met andere woorden, hij valt een stroman aan, in de hoop dat christenen als lostandfound dom genoeg zijn om er in te trappen. Wat rest is een hoop retoriek om wetenschappers belachelijk te maken..
Een betere uitleg vind je o.a. hier:
http://www.sciencedaily.com/releases/20 ... 115741.htm

Vin
Forum fan
Berichten: 282
Lid geworden op: 21 nov 2006 21:21

Bericht door Vin » 30 jun 2008 20:23

lostandfound schreef: nu wil ik wel graag het bewijs zien (...)
(graag geen valse bronnen gebruiken, zoals dat de mens zoveel op de aap lijkt ;)
Het vergelijk van de mens en de andere primaten is geen vals vergelijk of een valse bron.
Waarom stel je dat zo ?

Op dit filmpje http://www.ted.com/index.php/talks/susa ... write.html
kun je mooi zien hoe veel wij mensen gemeen hebben met de Bonobo.

Gebruikersavatar
af87
Forum fan
Berichten: 427
Lid geworden op: 06 aug 2006 20:37
Locatie: Utrecht
Contacteer:

Bericht door af87 » 30 jun 2008 20:30

..
lostandfound schreef: dat is denk ik bijna hetzelfde zeggen als er staan geen cijfers in een wiskunde boek.
Er staan wel cijfers in elk wiskunde boek. Echter het gaat om de getallen en formules. Cijfers en wiskunde is kinderpraat. Maar dan waarom de bijbel met een wiskunde boek vergelijken? Zijn ze dan beiden een constructie van de mens en zijn fantasiie. Welke vormt / bied dan naar jou perceptie gemeten een betere verklaring?
God is enkel een gedachte experiment..epic fail.

Gebruikersavatar
Erik
Bevlogen
Berichten: 4109
Lid geworden op: 02 mar 2005 18:06
Contacteer:

Bericht door Erik » 30 jun 2008 20:46

Wel ik zie dat Socratoteles en Sararje zich al hebben uitgeleefd op je "argumenten", ik zou enkel in herhaling vallen dus dat ga ik niet doen.
lostandfound schreef:Erik ten eerste bepaal ik niet wat christenzijn is, gelukig niet.
Oké, dan ga ik er nu even van uit dat Kenneth Miller het bij het rechte eind heeft en jij niet.
lostandfound schreef:Zelf geloof ik niet dat macro-evolutie in het christendom past, omdat dat het creationisme tegenspreekt.
En dat is exact de enige argumentatie die je hebt tegen de wetenschappelijke feiten ...... GELOOF!
Echter pech voor jou maar de feiten vertellen een heel ander verhaal.
Je kunt dan voor jezelf blijven herhalen dat het niet waar is want het conflicteert met "jouw" interpretatie van het christelijk dogma maar dat is verre van een solide argument.
lostandfound schreef:1 van de bewijzen, waar ik het over had
Het spijt me maar ik kan geen enkele referentie vinden naar welk wetenschappelijke publicatie dan ook waarin dit "bewijs" terug te vinden is.
Zeker niet in het stukje wat je nu met wat knip en plakwerk hebt geplaatst.
De inhoud van het stukje biedt vervolgens dan ook nog niet eens de wetenschappelijke referenties waarom ik je vroeg.
Wat het stukje wel goed weergeeft is de manier waarop de christelijke anti-evolutieclan het debat voert, namelijk veel leugens, quotemining, verdachtmakingen etc.
En de leken zoals jij die als de dood zijn van hun geloof te vallen slikken het als zoete koek.
Dat is het enige doel van dergelijke propaganda, het houdt de domme massa dom en onder controle.

Dus dit ene bewijs blijkt geen bewijs te zijn, maar aangezien je zo duidelijk laat blijken dat er nog meer bewijzen zijn zou ik zeggen waag nog een poging.
Misschien nu met een wetenschappelijk onderzoek erbij zonder zwartmakerij van bepaalde wetenschappelijke niches en wetenschappers.
Zie je ik ben er namelijk van overtuigd dat op het moment dat een wetenschappelijk debat gevoerd wordt zonder enige wetenschappelijke referentie naar onderzoeken maar alleen maar met weekend en story-verhaaltjes, er dan GEEN wetenschappelijke argumentatie is.
Die verhaaltjes leiden slechts de aandacht af van dit gebrek een stoken de onwetende christenleek op.
Dat is het enige doel!!
lostandfound schreef:Er staat wel heel degelijk wetenschap in de bijbel!
Ook in de koran beweren de sommige islamieten.
In beide gevallen kunnen ze het niet hardmaken.
lostandfound schreef:nu wil ik wel graag het bewijs zien, voro het ontstaan van de aarde.
Dat wil ik je best laten zien maar dan gaan we weer off-topic, dit valt namelijk buiten de evolutietheorie.
lostandfound schreef:het ontstaan van de mens uit een celletje.
Je gaat me toch niet vertellen dat ze je nog nooit over de bloemetjes en de bijtjes hebben verteld? :shock:
Nou vooruit beknopt:
Je pappa had geslachtsgemeenschap met je mama.
1 van papa's zaadjes is bij je mama's eitje terechtgekomen en heeft dat eitje bevrucht.
Daarna begint de celdeling en ontwikkelt zich een embryo.
Hier kun je dat in detail bekijken: http://yourembryo.blogspot.com/2007/06/ ... tages.html
En hier staat er wat over geschreven: http://nl.wikipedia.org/wiki/Zwangerschap
lostandfound schreef:graag geen valse bronnen gebruiken, zoals dat de mens zoveel op de aap lijkt
Sterker nog de mens deelt niet alleen een sterke uiterlijke gelijkenis ook in het DNA is de overeenkomst schokkend sterk aanwezig.
We zien daar zelfs het bewijs voor een gemeenschappelijke voorouder in de vorm van endogene retrovirussen.

Tot nog toe heb je niets van gebakken lostandfound, het valt me een beetje tegen.

Tot nog toe hebben we het ook alleen nog maar gehad over wat er zogenaamd niet zou kloppen in de evolutietheorie.
Dat is allemaal leuk en aardig maar ik heb je nog GEEN ENKELE alternatieve verklaring zien geven voor de waarnemingen die gedaan zijn op de vele wetenschappelijke gebieden.
Ik wil jou nu wel eens een verklaring/bewijzen zien leveren voor het fossielenbestand bijvoorbeeld en de DNA-bewijzen die de evolutietheorie levert.

Ik ben bijvoorbeeld erg benieuwd naar wat jou reactie op dit gedeelte van een lezing van Kenneth Miller is omtrent de relatie tussen mensen en primaten.
http://www.youtube.com/watch?v=Gs1zeWWIm5M

PS.
Aanbevolen lezenswaardige links:
http://www.talkorigins.org/faqs/comdesc/ (omtrent macro-evolutie)
Laatst gewijzigd door Erik op 01 jul 2008 10:38, 1 keer totaal gewijzigd.
De achtste hemel is het atheïstische inzicht dat de werkelijkheid weliswaar hard is maar wel de werkelijkheid en die is zoveel waardevoller dan alle mooie, verzachtende sprookjes bij elkaar. (Gerard)

Geleid wordt enkel hij die zichzelf niet gevonden heeft. (Rereformed)

Plaats reactie